Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGGAAAGAGCACATGAGGGTCTC[A/G]TCCACACTCATCATGGCGCCAGCAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 176875 MIM: 603761 MIM: 610831 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC100130987 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC100130987 - uncharacterized LOC100130987 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1CA - protein phosphatase 1 catalytic subunit alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001008709.1 | 1014 | Silent Mutation | GAC,GAT | D,D 297 | NP_001008709.1 | |
NM_002708.3 | 1014 | Silent Mutation | GAC,GAT | D,D 286 | NP_002699.1 | |
NM_206873.1 | 1014 | Silent Mutation | GAC,GAT | D,D 242 | NP_996756.1 |
RAD9A - RAD9 checkpoint clamp component A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243224.1 | 1014 | Intron | NP_001230153.1 | |||
NM_004584.2 | 1014 | Intron | NP_004575.1 | |||
XM_006718652.3 | 1014 | Intron | XP_006718715.1 | |||
XM_017018097.1 | 1014 | Intron | XP_016873586.1 | |||
XM_017018098.1 | 1014 | Intron | XP_016873587.1 |
TBC1D10C - TBC1 domain family member 10C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |