Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCCTGGTGGTGGCGGGCACTGTC[A/G]TCATGGTGACTGGGGTCTTGGGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602243 MIM: 614177 MIM: 601189 MIM: 602644 | ||||||||||||||||||||
Literature Links: |
CD151 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CD151 - CD151 molecule (Raph blood group) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039490.1 | 293 | Missense Mutation | ATC,GTC | I,V 71 | NP_001034579.1 | |
NM_004357.4 | 293 | Missense Mutation | ATC,GTC | I,V 71 | NP_004348.2 | |
NM_139029.1 | 293 | Missense Mutation | ATC,GTC | I,V 71 | NP_620598.1 | |
NM_139030.3 | 293 | Missense Mutation | ATC,GTC | I,V 71 | NP_620599.1 |
CRACR2B - calcium release activated channel regulator 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR2L - RNA polymerase II subunit L | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSPAN4 - tetraspanin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |