Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGAGCTAGTAAGAGTGCTGTCGGC[C/G]ATGCTTTTCCTGCTGATCGGCTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601998 MIM: 605720 | ||||||||||||||||||||
Literature Links: |
ESRRA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ESRRA - estrogen related receptor alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GPR137 - G protein-coupled receptor 137 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCNK4 - potassium two pore domain channel subfamily K member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317090.1 | 702 | Silent Mutation | GCC,GCG | A,A 172 | NP_001304019.1 | |
NM_033310.2 | 702 | Silent Mutation | GCC,GCG | A,A 172 | NP_201567.1 |
KCNK4-TEX40 - KCNK4-TEX40 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEX40 - testis expressed 40 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |