Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTATAGAAGGAGCTACAACTGGGTC[C/T]GGAATTATAGCTGCTAGCTTAGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600367 MIM: 612296 | ||||||||||||||||||||
Literature Links: |
CSTF3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CSTF3 - cleavage stimulation factor subunit 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001033505.1 | 1843 | Intron | NP_001028677.1 | |||
NM_001033506.1 | 1843 | Intron | NP_001028678.1 | |||
NM_001326.2 | 1843 | Silent Mutation | CCA,CCG | P,P 559 | NP_001317.1 |
LINC00294 - long intergenic non-protein coding RNA 294 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCP11L1 - t-complex 11 like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |