Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGACGGAGTATGACACGCTGCCTTC[C/T]GACACAGTCTCCCTCAGTGACTCGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 186845 MIM: 604600 MIM: 603852 | ||||||||||||||||||||
Literature Links: |
CD81 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CD81 - CD81 molecule | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRPM5 - transient receptor potential cation channel subfamily M member 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSSC4 - tumor suppressing subtransferable candidate 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297658.1 | 710 | Silent Mutation | TCC,TCT | S,S 26 | NP_001284587.1 | |
NM_001297659.1 | 710 | Silent Mutation | TCC,TCT | S,S 26 | NP_001284588.1 | |
NM_001297660.1 | 710 | Silent Mutation | TCC,TCT | S,S 26 | NP_001284589.1 | |
NM_001297661.1 | 710 | Intron | NP_001284590.1 | |||
NM_005706.3 | 710 | Silent Mutation | TCC,TCT | S,S 26 | NP_005697.2 | |
XM_006718118.2 | 710 | Silent Mutation | TCC,TCT | S,S 26 | XP_006718181.1 | |
XM_011519830.2 | 710 | Silent Mutation | TCC,TCT | S,S 26 | XP_011518132.1 |