Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATAAAATGCTAAATCATGAAAATGT[A/G]GTAAAATTCTATGGTCACAGGAGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603078 MIM: 601134 | ||||||||||||||||||||
Literature Links: |
CHEK1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHEK1 - checkpoint kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001114121.2 | 285 | Silent Mutation | GTA,GTG | V,V 67 | NP_001107593.1 | |
NM_001114122.2 | 285 | Silent Mutation | GTA,GTG | V,V 67 | NP_001107594.1 | |
NM_001244846.1 | 285 | Silent Mutation | GTA,GTG | V,V 67 | NP_001231775.1 | |
NM_001274.5 | 285 | Silent Mutation | GTA,GTG | V,V 67 | NP_001265.2 | |
XM_011542560.2 | 285 | Intron | XP_011540862.1 | |||
XM_011542561.2 | 285 | Intron | XP_011540863.1 | |||
XM_011542562.2 | 285 | Intron | XP_011540864.1 | |||
XM_011542563.2 | 285 | Intron | XP_011540865.1 | |||
XM_017017146.1 | 285 | Silent Mutation | GTA,GTG | V,V 67 | XP_016872635.1 |
STT3A - STT3A, catalytic subunit of the oligosaccharyltransferase complex | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |