Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGGGACACTGCCATCCTCTTCAC[C/T]AGGCAGGTGAGTTGATCTGCCGTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607509 | ||||||||||||||||||||
Literature Links: |
ADAMTS15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADAMTS15 - ADAM metallopeptidase with thrombospondin type 1 motif 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_139055.3 | 951 | Silent Mutation | ACC,ACT | T,T 317 | NP_620686.1 | |
XM_005271419.4 | 951 | Intron | XP_005271476.1 |
LOC646383 - uncharacterized LOC646383 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |