Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTATCACCTTCCCAGGCATGGGC[A/G]CCCCGATCTGGCCCTTCACGTCCTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616109 MIM: 612810 MIM: 608786 MIM: 605385 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C11orf80 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C11orf80 - chromosome 11 open reading frame 80 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRFN4 - leucine rich repeat and fibronectin type III domain containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PC - pyruvate carboxylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000920.3 | 3482 | Missense Mutation | NP_000911.2 | |||
NM_001040716.1 | 3482 | Missense Mutation | NP_001035806.1 | |||
NM_022172.2 | 3482 | Missense Mutation | NP_071504.2 | |||
XM_005274031.4 | 3482 | Missense Mutation | XP_005274088.1 | |||
XM_005274032.4 | 3482 | Missense Mutation | XP_005274089.1 | |||
XM_006718578.3 | 3482 | Missense Mutation | XP_006718641.1 | |||
XM_006718579.3 | 3482 | Missense Mutation | XP_006718642.1 | |||
XM_011545086.2 | 3482 | Missense Mutation | XP_011543388.1 | |||
XM_011545087.2 | 3482 | Missense Mutation | XP_011543389.1 | |||
XM_017017868.1 | 3482 | Missense Mutation | XP_016873357.1 | |||
XM_017017869.1 | 3482 | Missense Mutation | XP_016873358.1 | |||
XM_017017870.1 | 3482 | Missense Mutation | XP_016873359.1 | |||
XM_017017871.1 | 3482 | Missense Mutation | XP_016873360.1 | |||
XM_017017872.1 | 3482 | Missense Mutation | XP_016873361.1 |
RCE1 - Ras converting CAAX endopeptidase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |