Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAGGCTAATGATGACAAGAAGCC[A/G]ACCACTAAATTTGAACTAGAGCGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608757 MIM: 609725 MIM: 614586 | ||||||||||||||||||||
Literature Links: |
CLP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLP1 - cleavage and polyadenylation factor I subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142597.1 | 172 | Silent Mutation | CCA,CCG | P,P 11 | NP_001136069.1 | |
NM_006831.2 | 172 | Silent Mutation | CCA,CCG | P,P 11 | NP_006822.1 |
YPEL4 - yippee like 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZDHHC5 - zinc finger DHHC-type containing 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |