Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCTGTGGCAATGACTCCACCATG[G/T]GGAAAAAATGTGCAGCAAAGCCCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600407 | ||||||||||||||||||||
Literature Links: |
RFC5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
RFC5 - replication factor C subunit 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WSB2 - WD repeat and SOCS box containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278557.1 | 1092 | Silent Mutation | CCA,CCC | P,P 360 | NP_001265486.1 | |
NM_001278558.1 | 1092 | Silent Mutation | CCA,CCC | P,P 133 | NP_001265487.1 | |
NM_018639.4 | 1092 | Silent Mutation | CCA,CCC | P,P 343 | NP_061109.1 | |
XM_017019642.1 | 1092 | Silent Mutation | CCA,CCC | P,P 133 | XP_016875131.1 |