Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCAGGATGAGTTCAAGCGTCTTGC[C/T]GAAAACTCGGCTTCCAGCGATGATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602287 MIM: 612755 | ||||||||||||||||||||
Literature Links: |
ERP29 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ERP29 - endoplasmic reticulum protein 29 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001034025.1 | 349 | Intron | NP_001029197.1 | |||
NM_006817.3 | 349 | Silent Mutation | GCC,GCT | A,A 77 | NP_006808.1 | |
XM_017018720.1 | 349 | Intron | XP_016874209.1 |
NAA25 - N(alpha)-acetyltransferase 25, NatB auxiliary subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM116 - transmembrane protein 116 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |