Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATTCGAGTCACCTTCCCAAATTCC[A/G]ATGAAGAATCCGGAGCTCTTCTGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606383 MIM: 609124 | ||||||||||||||||||||
Literature Links: |
GPR84 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GPR84 - G protein-coupled receptor 84 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020370.2 | 1724 | Missense Mutation | TCG,TTG | S,L 312 | NP_065103.1 | |
XM_011538495.2 | 1724 | Missense Mutation | TCG,TTG | S,L 312 | XP_011536797.1 |
LOC102724050 - uncharacterized LOC102724050 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF385A - zinc finger protein 385A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |