Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTAGAGCTAAGGTCTTTCCCTGGGA[A/G]TCCCTGAATTCACTTGCACTCCCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608246 MIM: 608247 | ||||||||||||||||||||
Literature Links: |
KRT72 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KRT72 - keratin 72 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KRT73 - keratin 73 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_175068.2 | 3082 | Silent Mutation | GAC,GAT | D,D 523 | NP_778238.1 | |
XM_011538257.2 | 3082 | Silent Mutation | GAC,GAT | D,D 491 | XP_011536559.1 |
KRT73-AS1 - KRT73 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |