Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTGGGACTCCATGAAGTCTGAGC[A/G]TGTGGGTAAGGGCCAGCCCTGGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607749 MIM: 139130 MIM: 610342 MIM: 601447 | ||||||||||||||||||||
Literature Links: |
CDCA3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDCA3 - cell division cycle associated 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297602.1 | 1121 | Intron | NP_001284531.1 | |||
NM_001297603.1 | 1121 | Intron | NP_001284532.1 | |||
NM_001297604.1 | 1121 | Intron | NP_001284533.1 | |||
NM_031299.5 | 1121 | Intron | NP_112589.1 |
GNB3 - G protein subunit beta 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297571.1 | 1121 | Missense Mutation | CAT,CGT | H,R 303 | NP_001284500.1 | |
NM_002075.3 | 1121 | Missense Mutation | CAT,CGT | H,R 304 | NP_002066.1 | |
XM_011520953.2 | 1121 | Missense Mutation | CAT,CGT | H,R 304 | XP_011519255.1 |
P3H3 - prolyl 3-hydroxylase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP5 - ubiquitin specific peptidase 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |