Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTGAAGGAGTGCTCATTGATGTGC[C/T]TCATCTGCTCCATGAGCCGCATGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600294 | ||||||||||||||||||||
Literature Links: |
ADCY6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADCY6 - adenylate cyclase 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015270.4 | 3569 | Missense Mutation | AAG,AGG | K,R 1071 | NP_056085.1 | |
XM_006719210.3 | 3569 | Missense Mutation | AAG,AGG | K,R 1071 | XP_006719273.1 | |
XM_017018743.1 | 3569 | Missense Mutation | AAG,AGG | K,R 970 | XP_016874232.1 |
LINC00935 - long intergenic non-protein coding RNA 935 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4701 - microRNA 4701 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |