Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGGTCGCTGCCCATGATGGACAC[A/G]CTAGCGGCAAAGGAACCGTCGATGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607668 MIM: 608920 | ||||||||||||||||||||
Literature Links: |
ARL6IP4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARL6IP4 - ADP ribosylation factor like GTPase 6 interacting protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OGFOD2 - 2-oxoglutarate and iron dependent oxygenase domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PITPNM2 - phosphatidylinositol transfer protein membrane associated 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300801.1 | 3818 | Silent Mutation | AGC,AGT | S,S 1113 | NP_001287730.1 | |
NM_020845.2 | 3818 | Silent Mutation | AGC,AGT | S,S 1119 | NP_065896.1 | |
XM_011538590.2 | 3818 | Silent Mutation | AGC,AGT | S,S 1152 | XP_011536892.1 |