Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTAGCTCAGGGCTCCCAGGCCTCAC[A/G]GAACGTCAGCAACGATCCCGATGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616598 | ||||||||||||||||||||
Literature Links: |
BORCS5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BORCS5 - BLOC-1 related complex subunit 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011520551.2 | 150 | Missense Mutation | CAG,CGG | Q,R 15 | XP_011518853.1 | |
XM_011520552.2 | 150 | Intron | XP_011518854.1 | |||
XM_011520553.2 | 150 | Missense Mutation | CAG,CGG | Q,R 45 | XP_011518855.1 | |
XM_017018778.1 | 150 | Missense Mutation | CAG,CGG | Q,R 45 | XP_016874267.1 |
LOH12CR2 - loss of heterozygosity, 12, chromosomal region 2 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |