Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCAGACACTGCCCTCGCCCGAGGC[A/G]GACGCGCTCGCCGGCAGCAAGCACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142970 MIM: 142971 MIM: 609687 | ||||||||||||||||||||
Literature Links: |
HOXC-AS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HOXC-AS1 - HOXC cluster antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXC-AS2 - HOXC cluster antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXC8 - homeobox C8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXC9 - homeobox C9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107984512 - uncharacterized LOC107984512 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR196A2 - microRNA 196a-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |