Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCACACCACCCTGTTGGATATCAC[C/T]GATCCCCAGAGCGTCCAGCAGGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601444 MIM: 155740 MIM: 600536 MIM: 601617 | ||||||||||||||||||||
Literature Links: |
BLOC1S1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BLOC1S1 - biogenesis of lysosomal organelles complex 1 subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BLOC1S1-RDH5 - BLOC1S1-RDH5 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CD63 - CD63 molecule | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ITGA7 - integrin subunit alpha 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RDH5 - retinol dehydrogenase 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199771.1 | 435 | Silent Mutation | ACC,ACT | T,T 84 | NP_001186700.1 | |
NM_002905.3 | 435 | Silent Mutation | ACC,ACT | T,T 84 | NP_002896.2 |