Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCCTGGGGAGGAGGGACAGCAGC[C/T]GGGCCGCAAGCAGGGTAGGAGTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603928 MIM: 607717 | ||||||||||||||||||||
Literature Links: |
EIF4B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EIF4B - eukaryotic translation initiation factor 4B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC283335 - uncharacterized LOC283335 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6757 - microRNA 6757 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNS2 - tensin 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015319.2 | 215 | Intron | NP_056134.2 | |||
NM_170754.2 | 215 | Silent Mutation | CGG,TGG | R,W 21 | NP_736610.2 | |
NM_198316.1 | 215 | Intron | NP_938072.1 | |||
XM_006719302.3 | 215 | Intron | XP_006719365.1 | |||
XM_006719303.1 | 215 | Silent Mutation | CGG,TGG | R,W 21 | XP_006719366.1 | |
XM_011538079.1 | 215 | Intron | XP_011536381.1 | |||
XM_017019088.1 | 215 | Intron | XP_016874577.1 | |||
XM_017019089.1 | 215 | Intron | XP_016874578.1 |