Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATTAGAATCCTATTCCATTGCGGG[C/T]AGTGAGGGGAGTATATCGGCTTCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610215 MIM: 613142 | ||||||||||||||||||||
Literature Links: |
ARHGEF25 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARHGEF25 - Rho guanine nucleotide exchange factor 25 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001111270.2 | 271 | Silent Mutation | GGC,GGT | G,G 78 | NP_001104740.1 | |
NM_182947.3 | 271 | Silent Mutation | GGC,GGT | G,G 39 | NP_891992.2 |
DTX3 - deltex E3 ubiquitin ligase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927583 - uncharacterized LOC101927583 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIP4K2C - phosphatidylinositol-5-phosphate 4-kinase type 2 gamma | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC26A10 - solute carrier family 26 member 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |