Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGGAAGACCATACCCTAGGAAAT[G/T]CTCTACGTTACATGATCATGAAGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609733 MIM: 613715 | ||||||||||||||||||||
Literature Links: |
LNX2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LNX2 - ligand of numb-protein X 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR1D - RNA polymerase I subunit D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206559.1 | 1205 | Intron | NP_001193488.1 | |||
NM_015972.3 | 1205 | Missense Mutation | GCT,TCT | A,S 54 | NP_057056.1 | |
NM_152705.2 | 1205 | Intron | NP_689918.1 | |||
XM_005266412.1 | 1205 | Missense Mutation | GCT,TCT | A,S 54 | XP_005266469.1 | |
XM_005266414.2 | 1205 | Intron | XP_005266471.1 | |||
XM_017020622.1 | 1205 | Intron | XP_016876111.1 | |||
XM_017020623.1 | 1205 | Intron | XP_016876112.1 |