Search Thermo Fisher Scientific
AAACTGGAACTTCTGCGAGATGATA[A/C]CTTCCTTGGCTTGGAGAACCTGGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609680 | ||||||||||||||||||||
Literature Links: |
MIR4500HG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR4500HG - MIR4500 host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLITRK5 - SLIT and NTRK like family member 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015567.1 | 1333 | Missense Mutation | AAC,ACC | N,T 148 | NP_056382.1 | |
XM_005254038.4 | 1333 | Missense Mutation | AAC,ACC | N,T 148 | XP_005254095.1 | |
XM_005254039.2 | 1333 | Missense Mutation | AAC,ACC | N,T 148 | XP_005254096.1 |