Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCACACAGGTGATGATGGCAAGCA[C/G]GGCGCCGGTGCTGAGCCCAGCAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604562 MIM: 611137 | ||||||||||||||||||||
Literature Links: |
ACIN1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACIN1 - apoptotic chromatin condensation inducer 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CDH24 - cadherin 24 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022478.3 | 2184 | Silent Mutation | CTG,GTG | L,V 642 | NP_071923.2 | |
NM_144985.3 | 2184 | Silent Mutation | CTG,GTG | L,V 604 | NP_659422.2 | |
XM_011537089.1 | 2184 | Intron | XP_011535391.1 |
LOC105370705 - collagen alpha-2(I) chain-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSMB11 - proteasome subunit beta 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |