Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTAAACCAGTTGCTGACCTGGGTG[A/G]TGGTGAGGCCGGTGGCCTCGGCCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601205 | ||||||||||||||||||||
Literature Links: |
LOC105378189 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105378189 - uncharacterized LOC105378189 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SALRNA1 - senescence associated long non-coding RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIX1 - SIX homeobox 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005982.3 | 794 | Missense Mutation | ACC,ATC | T,I 165 | NP_005973.1 | |
XM_017021602.1 | 794 | Missense Mutation | ACC,ATC | T,I 165 | XP_016877091.1 |