Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCGAGGCATGCTTGACACACATCA[C/T]AAACTCTGCACATTCATTCTCAAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601710 | ||||||||||||||||||||
Literature Links: |
EIF5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EIF5 - eukaryotic translation initiation factor 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001969.4 | 938 | Silent Mutation | CAC,CAT | H,H 135 | NP_001960.2 | |
NM_183004.4 | 938 | Silent Mutation | CAC,CAT | H,H 135 | NP_892116.2 |
LOC105370687 - translation initiation factor IF-2-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA28 - small nucleolar RNA, H/ACA box 28 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |