Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGTATATCGCATGTTCTTCCTTGC[C/T]CTCAGGCTTAGATATGACCTGGGTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610781 MIM: 603171 MIM: 190195 MIM: 604319 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GMPR2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GMPR2 - guanosine monophosphate reductase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEDD8 - neural precursor cell expressed, developmentally down-regulated 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEDD8-MDP1 - NEDD8-MDP1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TGM1 - transglutaminase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TINF2 - TERF1 interacting nuclear factor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099274.1 | 787 | Missense Mutation | AGC,GGC | S,G 305 | NP_001092744.1 | |
NM_012461.2 | 787 | Missense Mutation | AGC,GGC | S,G 305 | NP_036593.2 | |
XM_005267529.3 | 787 | Missense Mutation | AGC,GGC | S,G 270 | XP_005267586.1 | |
XM_011536642.2 | 787 | UTR 3 | XP_011534944.1 | |||
XM_017021216.1 | 787 | Missense Mutation | AGC,GGC | S,G 91 | XP_016876705.1 | |
XM_017021217.1 | 787 | Missense Mutation | AGC,GGC | S,G 91 | XP_016876706.1 |