Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGGTCCACTAACCCTCAGTATCAA[A/G]TCCATCCCCGAGGCTCCTGGAAACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616358 MIM: 613654 MIM: 616036 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR1193 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR1193 - microRNA 1193 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1197 - microRNA 1197 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR299 - microRNA 299 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR323A - microRNA 323a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR329-1 - microRNA 329-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR329-2 - microRNA 329-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR379 - microRNA 379 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR380 - microRNA 380 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR411 - microRNA 411 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR494 - microRNA 494 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR543 - microRNA 543 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR758 - microRNA 758 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |