Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCACAGGTAGAGCGCACAGAGGTG[A/C]TTCGCTCCTGTTCCAGCCCTGTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614716 MIM: 605688 MIM: 162080 | ||||||||||||||||||||
Literature Links: |
CARMIL3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CARMIL3 - capping protein regulator and myosin 1 linker 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CPNE6 - copine 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001280558.1 | 442 | Missense Mutation | ATT,CTT | I,L 118 | NP_001267487.1 | |
NM_006032.3 | 442 | Missense Mutation | ATT,CTT | I,L 63 | NP_006023.1 | |
XM_005268216.1 | 442 | Missense Mutation | ATT,CTT | I,L 63 | XP_005268273.1 | |
XM_005268217.1 | 442 | UTR 5 | XP_005268274.1 |
NRL - neural retina leucine zipper | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |