Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCGGCAGCCCCACGGCCACCATG[A/T]GCGGCGTACGGCCCTGCTCCGCGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608110 MIM: 604114 | ||||||||||||||||||||
Literature Links: |
ANKRD63 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKRD63 - ankyrin repeat domain 63 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001190479.2 | 152 | Missense Mutation | CAC,CTC | H,L 51 | NP_001177408.1 |
BUB1B-PAK6 - BUB1B-PAK6 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAK6 - p21 (RAC1) activated kinase 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLCB2 - phospholipase C beta 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |