Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATAATTTAATAGAGAAACAATGAA[C/T]GATACTCTTTACACTCAGCCTCCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609585 MIM: 606912 MIM: 613472 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CPLX3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CPLX3 - complexin 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6882 - microRNA 6882 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCAMP2 - secretory carrier membrane protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ULK3 - unc-51 like kinase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099436.3 | 2656 | UTR 3 | NP_001092906.3 | |||
NM_001284364.2 | 2656 | UTR 3 | NP_001271293.2 | |||
NM_001284365.2 | 2656 | UTR 3 | NP_001271294.1 | |||
XM_005254289.2 | 2656 | UTR 3 | XP_005254346.1 | |||
XM_017022068.1 | 2656 | UTR 3 | XP_016877557.1 | |||
XM_017022069.1 | 2656 | UTR 3 | XP_016877558.1 | |||
XM_017022070.1 | 2656 | UTR 3 | XP_016877559.1 | |||
XM_017022071.1 | 2656 | UTR 3 | XP_016877560.1 | |||
XM_017022072.1 | 2656 | UTR 3 | XP_016877561.1 |