Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTCTCTGGCTGCCCACGGCCTGCA[A/G]CCACAGGCTCCAGACACGCACGGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606088 MIM: 605916 | ||||||||||||||||||||
Literature Links: |
JMJD7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
JMJD7 - jumonji domain containing 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
JMJD7-PLA2G4B - JMJD7-PLA2G4B readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198588.1 | 232 | Missense Mutation | AAC,AGC | N,S 275 | NP_001185517.1 | |
NM_005090.3 | 232 | Missense Mutation | AAC,AGC | N,S 275 | NP_005081.1 |
PLA2G4B - phospholipase A2 group IVB | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001114633.1 | 232 | Missense Mutation | AAC,AGC | N,S 44 | NP_001108105.1 |
SPTBN5 - spectrin beta, non-erythrocytic 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |