Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTTAGTGTGGCAGAAAAGGAGTTT[C/T]TACATACTGTACACAAAACAGACAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610835 MIM: 600825 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ICE2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ICE2 - interactor of little elongation complex ELL subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RORA - RAR related orphan receptor A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002943.3 | 10316 | UTR 3 | NP_002934.1 | |||
NM_134260.2 | 10316 | UTR 3 | NP_599022.1 | |||
NM_134261.2 | 10316 | UTR 3 | NP_599023.1 | |||
NM_134262.2 | 10316 | UTR 3 | NP_599024.1 | |||
XM_005254584.4 | 10316 | UTR 3 | XP_005254641.1 | |||
XM_011521874.1 | 10316 | UTR 3 | XP_011520176.1 | |||
XM_011521875.1 | 10316 | UTR 3 | XP_011520177.1 | |||
XM_011521877.2 | 10316 | UTR 3 | XP_011520179.1 | |||
XM_011521878.1 | 10316 | UTR 3 | XP_011520180.1 | |||
XM_011521879.2 | 10316 | UTR 3 | XP_011520181.1 | |||
XM_017022466.1 | 10316 | UTR 3 | XP_016877955.1 | |||
XM_017022467.1 | 10316 | UTR 3 | XP_016877956.1 |
RORA-AS1 - RORA antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |