Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCTGGGGATATGATGCGGTGGCGG[C/T]GGCGCCTCAAGATAAGGGGCTGGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612784 MIM: 600215 MIM: 605054 MIM: 614550 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HYPK PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HYPK - huntingtin interacting protein K | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFAP1 - microfibrillar associated protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1282 - microRNA 1282 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SERF2 - small EDRK-rich factor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018108.3 | 1451 | UTR 3 | NP_001018118.1 | |||
NM_001199875.1 | 1451 | UTR 3 | NP_001186804.1 | |||
NM_001199876.1 | 1451 | UTR 3 | NP_001186805.1 | |||
NM_001199877.1 | 1451 | UTR 3 | NP_001186806.1 | |||
NM_001199878.1 | 1451 | UTR 3 | NP_001186807.1 |
SERF2-C15ORF63 - SERF2-C15orf63 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SERINC4 - serine incorporator 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258031.1 | 1451 | Missense Mutation | CAC,CGC | H,R 504 | NP_001244960.1 | |
NM_001258032.1 | 1451 | Missense Mutation | CAC,CGC | H,R 260 | NP_001244961.1 |