Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCGCGGGGGGCTGGCATTCTGTG[C/T]GTGTGAGTGGTGAGTGACTTAGTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603484 MIM: 611219 | ||||||||||||||||||||
Literature Links: |
PRC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PRC1 - protein regulator of cytokinesis 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRC1-AS1 - PRC1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RCCD1 - RCC1 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001017919.1 | 866 | Missense Mutation | CGT,TGT | R,C 224 | NP_001017919.1 | |
NM_033544.2 | 866 | Missense Mutation | CGT,TGT | R,C 224 | NP_291022.2 |
UNC45A - unc-45 myosin chaperone A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |