Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGGGTAGGAGCGCTGAAATCTCT[C/T]TTGTATACTTCTTCATCCTCATCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612784 MIM: 600215 MIM: 605054 MIM: 614550 | ||||||||||||||||||||
Literature Links: |
HYPK PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HYPK - huntingtin interacting protein K | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFAP1 - microfibrillar associated protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005926.2 | 1255 | Silent Mutation | AAA,AAG | K,K 357 | NP_005917.2 |
SERF2 - small EDRK-rich factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SERF2-C15ORF63 - SERF2-C15orf63 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SERINC4 - serine incorporator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |