Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTAGTTGTTGGAACATTGAAGAGA[C/T]GCTTCAAGAAATACAGTTGCAGGAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606979 | ||||||||||||||||||||
Literature Links: |
COG8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COG8 - component of oligomeric golgi complex 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NIP7 - NIP7, nucleolar pre-rRNA processing protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199434.1 | 730 | Intron | NP_001186363.1 | |||
NM_016101.4 | 730 | Intron | NP_057185.1 |
TMED6 - transmembrane p24 trafficking protein 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144676.3 | 730 | Missense Mutation | CAT,CGT | H,R 225 | NP_653277.2 |