Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGATGTACTCTGAGCGCAGAGGA[A/G]AGAGCCGCCCTCGAGCGGAGCAAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 139311 | ||||||||||||||||||||
Literature Links: |
DKFZP434H168 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DKFZP434H168 - uncharacterized LOC26077 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GNAO1 - G protein subunit alpha o1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020988.2 | 924 | Silent Mutation | GAA,GAG | E,E 9 | NP_066268.1 | |
NM_138736.2 | 924 | Silent Mutation | GAA,GAG | E,E 9 | NP_620073.2 | |
XM_011523003.2 | 924 | Intron | XP_011521305.1 |
LOC283856 - uncharacterized LOC283856 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |