Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCTGCCTATGGCACAGCCAAGAG[C/T]GGTACCGGCATTGCGGCCATGTCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 108745 MIM: 613577 | ||||||||||||||||||||
Literature Links: |
AMDHD2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AMDHD2 - amidohydrolase domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ATP6V0C - ATPase H+ transporting V0 subunit c | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198569.1 | 345 | Silent Mutation | AGC,AGT | S,S 37 | NP_001185498.1 | |
NM_001694.3 | 345 | Silent Mutation | AGC,AGT | S,S 37 | NP_001685.1 |
TBC1D24 - TBC1 domain family member 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |