Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGGATGGAGTCTTTGGAGATGAA[C/G]CTGACGAAGTTCTGCACGTCCGCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602622 MIM: 603022 MIM: 600305 | ||||||||||||||||||||
Literature Links: |
DNASE1L2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNASE1L2 - deoxyribonuclease I-like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
E4F1 - E4F transcription factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ECI1 - enoyl-CoA delta isomerase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001178029.1 | 872 | Silent Mutation | AGC,AGG | S,R 262 | NP_001171500.1 | |
NM_001919.3 | 872 | Silent Mutation | AGC,AGG | S,R 279 | NP_001910.2 |