Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCAAGGCTGTCAAAGACCAGCTCC[C/T]GTCTCTGGACTCAGACTCCCCTTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
ANKS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKS3 - ankyrin repeat and sterile alpha motif domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C16orf71 - chromosome 16 open reading frame 71 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_139170.2 | 184 | Missense Mutation | CCG,CTG | P,L 35 | NP_631909.2 | |
XM_005255144.3 | 184 | Intron | XP_005255201.1 | |||
XM_017022975.1 | 184 | Missense Mutation | CCG,CTG | P,L 58 | XP_016878464.1 | |
XM_017022976.1 | 184 | Missense Mutation | CCG,CTG | P,L 35 | XP_016878465.1 |
ZNF500 - zinc finger protein 500 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |