Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCTGGAGTCCTCCTGCTGGTTGAT[A/G]ACCGTCAGGGCGTCCTCGGAGGCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603870 | ||||||||||||||||||||
Literature Links: |
CBFA2T3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CBFA2T3 - CBFA2/RUNX1 translocation partner 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005187.5 | 1590 | Silent Mutation | GTC,GTT | V,V 545 | NP_005178.4 | |
NM_175931.2 | 1590 | Silent Mutation | GTC,GTT | V,V 459 | NP_787127.1 | |
XM_005256323.4 | 1590 | Silent Mutation | GTC,GTT | V,V 520 | XP_005256380.1 | |
XM_011523419.2 | 1590 | Silent Mutation | GTC,GTT | V,V 545 | XP_011521721.1 | |
XM_017023811.1 | 1590 | Intron | XP_016879300.1 |
LOC101927793 - uncharacterized LOC101927793 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PABPN1L - poly(A) binding protein nuclear 1 like (cytoplasmic) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |