Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGTTGACCTCGTGGGGGAACACA[C/T]GGCCCAGCCGGAGGGTACAGTCCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603246 MIM: 605383 | ||||||||||||||||||||
Literature Links: |
GTF3C1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GTF3C1 - general transcription factor IIIC subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286242.1 | 6131 | Missense Mutation | CAT,CGT | H,R 2070 | NP_001273171.1 | |
NM_001520.3 | 6131 | Missense Mutation | CAT,CGT | H,R 2095 | NP_001511.2 | |
XM_017023188.1 | 6131 | Missense Mutation | CAT,CGT | H,R 2032 | XP_016878677.1 |
IL21R - interleukin 21 receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IL21R-AS1 - IL21R antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |