Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTGTACAGCTCCTGAACCCCAGGC[A/G]CGTCCTCGGGCGCCTCAGCCCGGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614666 MIM: 611118 | ||||||||||||||||||||
Literature Links: |
CCDC78 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC78 - coiled-coil domain containing 78 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM173A - family with sequence similarity 173 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HAGHL - hydroxyacylglutathione hydrolase-like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001290137.1 | 1357 | Intron | NP_001277066.1 | |||
NM_001290139.1 | 1357 | Intron | NP_001277068.1 | |||
NM_001323635.1 | 1357 | Intron | NP_001310564.1 | |||
NM_001323636.1 | 1357 | Intron | NP_001310565.1 | |||
NM_032304.3 | 1357 | Intron | NP_115680.1 | |||
XM_005255631.4 | 1357 | Intron | XP_005255688.1 | |||
XM_005255632.1 | 1357 | Intron | XP_005255689.1 | |||
XM_011522711.1 | 1357 | Intron | XP_011521013.1 | |||
XM_011522712.1 | 1357 | Intron | XP_011521014.1 | |||
XM_017023773.1 | 1357 | Intron | XP_016879262.1 | |||
XM_017023774.1 | 1357 | Intron | XP_016879263.1 |
NARFL - nuclear prelamin A recognition factor like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304799.1 | 1357 | Missense Mutation | GCG,GTG | A,V 333 | NP_001291728.1 | |
NM_022493.2 | 1357 | Missense Mutation | GCG,GTG | A,V 435 | NP_071938.1 |