Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TACGCCTCGGGCTGGCCGCTGCAGA[A/G]CTTTCAGGGGTGGCCAGGTCCCCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603464 | ||||||||||||||||||||
Literature Links: |
CDK10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDK10 - cyclin dependent kinase 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPATA2L - spermatogenesis associated 2 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152339.3 | 1485 | Silent Mutation | AGC,AGT | S,S 327 | NP_689552.2 | |
XM_005256279.4 | 1485 | Silent Mutation | AGC,AGT | S,S 327 | XP_005256336.1 |
VPS9D1 - VPS9 domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |