Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCTGTTCCCACTTTCCCAGTGTT[C/T]GGCCAAGAACCTGAGGAACATCTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603264 MIM: 613889 MIM: 607207 | ||||||||||||||||||||
Literature Links: |
LOC105371184 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105371184 - uncharacterized LOC105371184 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RHBDL1 - rhomboid like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RHOT2 - ras homolog family member T2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138769.2 | 560 | Missense Mutation | TCG,TTG | S,L 148 | NP_620124.1 | |
XM_005255660.2 | 560 | Missense Mutation | TCG,TTG | S,L 148 | XP_005255717.1 | |
XM_005255661.2 | 560 | Missense Mutation | TCG,TTG | S,L 130 | XP_005255718.1 | |
XM_005255662.2 | 560 | Missense Mutation | TCG,TTG | S,L 130 | XP_005255719.1 | |
XM_005255663.2 | 560 | Missense Mutation | TCG,TTG | S,L 148 | XP_005255720.1 | |
XM_006720970.2 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_006721033.1 | |
XM_006720973.2 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_006721036.1 | |
XM_017023825.1 | 560 | Missense Mutation | TCG,TTG | S,L 148 | XP_016879314.1 | |
XM_017023826.1 | 560 | Missense Mutation | TCG,TTG | S,L 148 | XP_016879315.1 | |
XM_017023827.1 | 560 | Missense Mutation | TCG,TTG | S,L 130 | XP_016879316.1 | |
XM_017023828.1 | 560 | Missense Mutation | TCG,TTG | S,L 130 | XP_016879317.1 | |
XM_017023829.1 | 560 | Missense Mutation | TCG,TTG | S,L 148 | XP_016879318.1 | |
XM_017023830.1 | 560 | Missense Mutation | TCG,TTG | S,L 130 | XP_016879319.1 | |
XM_017023831.1 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_016879320.1 | |
XM_017023832.1 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_016879321.1 | |
XM_017023833.1 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_016879322.1 | |
XM_017023834.1 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_016879323.1 | |
XM_017023835.1 | 560 | Missense Mutation | TCG,TTG | S,L 21 | XP_016879324.1 | |
XM_017023836.1 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_016879325.1 | |
XM_017023837.1 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_016879326.1 | |
XM_017023838.1 | 560 | Missense Mutation | TCG,TTG | S,L 41 | XP_016879327.1 | |
XM_017023839.1 | 560 | Missense Mutation | TCG,TTG | S,L 21 | XP_016879328.1 | |
XM_017023840.1 | 560 | UTR 5 | XP_016879329.1 | |||
XM_017023841.1 | 560 | UTR 5 | XP_016879330.1 | |||
XM_017023842.1 | 560 | UTR 5 | XP_016879331.1 |
STUB1 - STIP1 homology and U-box containing protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR90 - WD repeat domain 90 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |