Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAAGGCCCAGCGCTGCCACGAGGT[A/G]GGGTAGCACTGGCGCCGGTGCCCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604853 | ||||||||||||||||||||
Literature Links: |
LOC100134368 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100134368 - uncharacterized LOC100134368 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL28 - mitochondrial ribosomal protein L28 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM8A - transmembrane protein 8A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021259.2 | 2184 | Silent Mutation | CCC,CCT | P,P 685 | NP_067082.2 |