Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTACTATGGCAACCTGATTGCTGT[A/G]TCTAACTCCTTCTTGGCCTATGCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606030 MIM: 605813 | ||||||||||||||||||||
Literature Links: |
EDC4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EDC4 - enhancer of mRNA decapping 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014329.4 | 659 | Silent Mutation | GTA,GTG | V,V 140 | NP_055144.3 |
NRN1L - neuritin 1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUTF2 - nuclear transport factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |