Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTGCGGTCCCAGGTGCGGCGGTC[A/G]CCCTGCCCCTGGAAGGACTGGCGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
C16orf86 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C16orf86 - chromosome 16 open reading frame 86 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ENKD1 - enkurin domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GFOD2 - glucose-fructose oxidoreductase domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243650.1 | 1004 | Intron | NP_001230579.1 | |||
NM_030819.3 | 1004 | Silent Mutation | GGC,GGT | G,G 322 | NP_110446.3 | |
XM_006721288.3 | 1004 | Silent Mutation | GGC,GGT | G,G 217 | XP_006721351.1 | |
XM_017023738.1 | 1004 | Silent Mutation | GGC,GGT | G,G 322 | XP_016879227.1 |