Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGTAATCTTGCAGCGTTGGGGGGA[A/T]ATCATAATTGACAACCAGCTCCACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607618 MIM: 609707 | ||||||||||||||||||||
Literature Links: |
DDX28 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DDX28 - DEAD-box helicase 28 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018380.3 | 2085 | Missense Mutation | ATC,TTC | I,F 474 | NP_060850.2 |
DUS2 - dihydrouridine synthase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100131303 - uncharacterized LOC100131303 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |